View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5725_low_37 (Length: 244)
Name: NF5725_low_37
Description: NF5725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5725_low_37 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 2462054 - 2461829
Alignment:
| Q |
1 |
aacgactatattttgtttgcttcacctgcatataacgcacacacatcaagaaccacttgaaattagtgctgccgattaaaattccggtgaccatatataa |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
2462054 |
aacgaccatattttgtttgcttcacctgcatataacgcacacacatcaagaaccacttgaaattagtgctgcagattaaaattccggtgaccatatataa |
2461955 |
T |
|
| Q |
101 |
ccaaccacattgctgcaaatgttttatgctctagaaattgcagcactctaactgtatagagtgcaccatctcaatcgttcacggaaactatgtagaacca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||| || ||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
2461954 |
ccaaccacattgctgcaaatgttttatgctctagaaattgcagca--ctaactgtacagtgtgcaccatctgaatcgttcacggaaactatgtagaaccg |
2461857 |
T |
|
| Q |
201 |
acacaatgtcagtgtcggacatcaacac |
228 |
Q |
| |
|
|||| ||||||||||||||||||||||| |
|
|
| T |
2461856 |
acaccatgtcagtgtcggacatcaacac |
2461829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University