View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5725_low_37 (Length: 244)

Name: NF5725_low_37
Description: NF5725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5725_low_37
NF5725_low_37
[»] chr3 (1 HSPs)
chr3 (1-228)||(2461829-2462054)


Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 2462054 - 2461829
Alignment:
1 aacgactatattttgtttgcttcacctgcatataacgcacacacatcaagaaccacttgaaattagtgctgccgattaaaattccggtgaccatatataa 100  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
2462054 aacgaccatattttgtttgcttcacctgcatataacgcacacacatcaagaaccacttgaaattagtgctgcagattaaaattccggtgaccatatataa 2461955  T
101 ccaaccacattgctgcaaatgttttatgctctagaaattgcagcactctaactgtatagagtgcaccatctcaatcgttcacggaaactatgtagaacca 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||  ||||||||| || ||||||||||| |||||||||||||||||||||||||||     
2461954 ccaaccacattgctgcaaatgttttatgctctagaaattgcagca--ctaactgtacagtgtgcaccatctgaatcgttcacggaaactatgtagaaccg 2461857  T
201 acacaatgtcagtgtcggacatcaacac 228  Q
    |||| |||||||||||||||||||||||    
2461856 acaccatgtcagtgtcggacatcaacac 2461829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University