View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5725_low_44 (Length: 204)
Name: NF5725_low_44
Description: NF5725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5725_low_44 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 117; Significance: 8e-60; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 117; E-Value: 8e-60
Query Start/End: Original strand, 7 - 185
Target Start/End: Original strand, 15049055 - 15049231
Alignment:
| Q |
7 |
tccaagaatatattgttgttattgaaatggttttgaaaaataaaaattgatgacggcccctcagaaaatgtcaatgatatcaactttcaattatttgnnn |
106 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
15049055 |
tccaaaaatatattgttgttattgaaatggttttgaaaaataaaaatttatgacggcccctcagaaaatgtcaatgctatcaactttcaataatttg--t |
15049152 |
T |
 |
| Q |
107 |
nnnnnnnnagggaaactttcaaatagttgttgttattctatattattacaatggctattattacatatttaatttgaaa |
185 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
15049153 |
ttttttttagggaaactttcaaatagttgttgttattgtatattattacaatggctattgttacatatttaatttgaaa |
15049231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 156 - 185
Target Start/End: Original strand, 15049274 - 15049303
Alignment:
| Q |
156 |
aatggctattattacatatttaatttgaaa |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
15049274 |
aatggctattattacatatttaatttgaaa |
15049303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University