View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5726-Insertion-1 (Length: 153)
Name: NF5726-Insertion-1
Description: NF5726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5726-Insertion-1 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 61; Significance: 2e-26; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 85 - 153
Target Start/End: Complemental strand, 2705765 - 2705697
Alignment:
| Q |
85 |
tctttcaggtttcaagagatagtacctttaaagacctcaacagtaataggggcataagatccatcagtg |
153 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2705765 |
tctttcaggtttcaagagatagtacctttgaagacctcaacagtaataggggcagaagatccatcagtg |
2705697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 11 - 89
Target Start/End: Complemental strand, 2705878 - 2705800
Alignment:
| Q |
11 |
attgcattaaggtttggccttactttgacgccaataaaatcctctacttttttgtttcaaaggaaaatgattattcttt |
89 |
Q |
| |
|
|||||||||||||||| || |||| || ||||||||||||||||||||||| ||||| | |||| || ||||||||| |
|
|
| T |
2705878 |
attgcattaaggtttgaccctactcggagcccaataaaatcctctacttttttatttcataagaaagtgcttattcttt |
2705800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University