View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5726_high_1 (Length: 734)
Name: NF5726_high_1
Description: NF5726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5726_high_1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 147; Significance: 4e-77; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 147; E-Value: 4e-77
Query Start/End: Original strand, 321 - 593
Target Start/End: Complemental strand, 38938785 - 38938517
Alignment:
| Q |
321 |
agagattaaaacattaacataaaggccatatactcagagacacagggcacaccttcaaaaggctatagctcttgtttttcatatactatttattatatct |
420 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| | ||| ||| |||| || ||||||||| || ||||||| ||| |||||| | |||||||| |
|
|
| T |
38938785 |
agagattaaaacattagcataaaggccatatacac-tagagacatggcaaacattcaaaaggttaatactcttgtcttttatatac---tgcttatatct |
38938690 |
T |
 |
| Q |
421 |
ttgcttccatttcaaatcatagcatcaataaaaacagaagcagaagctcttgtcaaatggaaaaatagtttatcccatcctttgccttctcctctcaact |
520 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
38938689 |
ttgcttccattgaaaatcacagcatcaataaaaacagaagcagaagctcttgtcaaatggaaaaatagtttatcccatcctttgccttctcctctcaatt |
38938590 |
T |
 |
| Q |
521 |
catggttgctcaccaatcttaccaacctttgcagttggaatgctgttgtttgtgacaacaccaatacaactgt |
593 |
Q |
| |
|
|||||| |||||||||||| ||||||||||| |||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
38938589 |
catggtctatcaccaatcttatcaacctttgcaattgggatgctattgtttgtgacaacaccaatacaactgt |
38938517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 611 - 714
Target Start/End: Complemental strand, 38938452 - 38938349
Alignment:
| Q |
611 |
ctcccaaacctaaccgtcctcaatctcaatgacaacagttttggtggatcaataccatcatcaattggcaaactctccaagctcactttcttagacttgg |
710 |
Q |
| |
|
||||||||||| ||| ||||||| ||||||| |||||| ||||||||||||||||||||||||||||||| |||||| ||||||| |||||||||||||| |
|
|
| T |
38938452 |
ctcccaaacctcaccctcctcaacctcaatggcaacaggtttggtggatcaataccatcatcaattggcacactctcaaagctcaatttcttagacttgg |
38938353 |
T |
 |
| Q |
711 |
gaaa |
714 |
Q |
| |
|
|||| |
|
|
| T |
38938352 |
gaaa |
38938349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University