View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5726_high_12 (Length: 318)
Name: NF5726_high_12
Description: NF5726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5726_high_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 19 - 305
Target Start/End: Original strand, 34334771 - 34335057
Alignment:
| Q |
19 |
ataaagctagacatataagacaatagtccctaccctaaaccagaaaacaggaccaaagcataaaaatccacaaacaataacagcaagctaaaatttcaga |
118 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34334771 |
ataaagctagacatataagacaacagtccctaccctaaaccagaaaacaggaccaaagcataaaaatccacaaacaataacagcaagctaaaatttcaga |
34334870 |
T |
 |
| Q |
119 |
ggccaaagaccatacataaaaggccacagaagctactattcttgtttctttcacatggccagttccttcgtgataagtttgtaaatcatccctgcctaaa |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34334871 |
ggccaaagaccatacataaaaggccacagaagctactattcttgtttctttcacatgactagttccttcgtgataagtttgtaaatcatccctgcctaaa |
34334970 |
T |
 |
| Q |
219 |
gcacatgttagacataatatttgaactttagagtttaggaataccatgtcagattcgtctttggtctagtcttcttcgaattgcttc |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
34334971 |
gcacatgttagacataatatttgaactttagagtttaggaataccatgtcagatttgtctttggtctagtcttcttcgaattgcttc |
34335057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University