View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5726_high_13 (Length: 285)

Name: NF5726_high_13
Description: NF5726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5726_high_13
NF5726_high_13
[»] chr4 (1 HSPs)
chr4 (111-189)||(32811505-32811583)


Alignment Details
Target: chr4 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 111 - 189
Target Start/End: Original strand, 32811505 - 32811583
Alignment:
111 tgcaccattagggttggatgaagcaaatacagcgaaactcctcaaagtatttggaacctgcaaaacaaaatttgccatg 189  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
32811505 tgcaccattagggttggatgaagcaaatacagtgaaactcctcaaagtatttggaacctgcaaaacaaaatttgccatg 32811583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University