View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5726_low_11 (Length: 362)
Name: NF5726_low_11
Description: NF5726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5726_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 7 - 348
Target Start/End: Complemental strand, 5527351 - 5527011
Alignment:
| Q |
7 |
ctctcttctttagggtgggtgactgatgtttggtccgaaccctttctttttgctaaagaaaaccacagtggtaatttgagtagatacttataattcccaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5527351 |
ctctcttctttagggtgggtgactgatgtttggtcccaaccctttctttttgctaaagaaaaccacagtggtaatttgagtagatacttataattcccaa |
5527252 |
T |
|
| Q |
107 |
ttgcagtaaaaaccggatgtcaatttctttgttacctttaggctttttcctctaagcctatataaattttagttgatgggtccaaattcaaccacccaaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5527251 |
ttgcagtaaaaaccggatgtcaatttctttgttacctttaggcttttttctctaagcctatataaattttagttgatgagtccaaattcaaccacccaaa |
5527152 |
T |
|
| Q |
207 |
aagatgtaggagataaatcgaagggtcgtctgccaccattgcctagttagattagatgaacaaaactagnnnnnnnnnttatagtacttgtttctcttat |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5527151 |
aagatgtaggagataaatcgaagggtcgtctgccaccattgcctagttagattagatgaacaaaactag-aaaaaaaattatagtacttgtttctcttat |
5527053 |
T |
|
| Q |
307 |
gaatcaaaagtttatgccaatatttgtaatgtggtgtgtacc |
348 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5527052 |
gaatcaaaagtttatgccaatatttgtaatgtggtgtatacc |
5527011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University