View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5726_low_21 (Length: 267)
Name: NF5726_low_21
Description: NF5726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5726_low_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 250
Target Start/End: Original strand, 32811677 - 32811924
Alignment:
| Q |
1 |
acaagcatggcccaccattttcaacggccaagattcagtttttacaaaagggtaaaatatttcgcagnnnnnnnnnttaattaatctaactttacaacct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
32811677 |
acaagcatggcccaccattttcaacggccaagattcagtttttataaaagggtaaaatatttcgcagaaaaaaa--ttaattaatctaaatttacaacct |
32811774 |
T |
 |
| Q |
101 |
cattcgtttctaggaactatggcagctgctacggttcctttctctcttcttaggtaacaatattcactcttttgattcattcatgtgtttgatgtgtgaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32811775 |
cattcgtttctaggaactatggcagctgctacggttcctttctctcttattaggtaacaatattcactcttttgattcattcatgtgtttgatgtgtgaa |
32811874 |
T |
 |
| Q |
201 |
atattgaatcttgctttgaataatttgcaggaactactcacaattggtgt |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32811875 |
atattgaatcttgctttgaataatttgcaggaactactcacaattggtgt |
32811924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 125 - 205
Target Start/End: Original strand, 32804768 - 32804847
Alignment:
| Q |
125 |
gctgctacggttcctttctctcttcttaggtaacaatattcactcttttgattcattcatgtgtttgatgtgtgaaatatt |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||| ||||| || || ||||||||| |
|
|
| T |
32804768 |
gctgctacggttcctttctctcttcttaggt-acactattcactcttttgattcattcgtgtgtgtgttgcttgaaatatt |
32804847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University