View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5726_low_29 (Length: 229)
Name: NF5726_low_29
Description: NF5726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5726_low_29 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 112; Significance: 9e-57; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 21 - 136
Target Start/End: Complemental strand, 18316656 - 18316541
Alignment:
| Q |
21 |
ccttcatcctttttccaaacccttgattcaaatctagaagaagatggcaacggagagattctcttctcggccacccacatctcaagaagaaaacgctctg |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18316656 |
ccttcatcctttttccaaacccttgattcaaatctagaagaaaatggcaacggagagattctcttctcggccacccacatctcaagaagaaaacgctctg |
18316557 |
T |
|
| Q |
121 |
tcagtaatcacgctcc |
136 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
18316556 |
tcagtaatcacgctcc |
18316541 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 185 - 214
Target Start/End: Complemental strand, 18316492 - 18316463
Alignment:
| Q |
185 |
atgatgcatgcaaaatcaagctttattttt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
18316492 |
atgatgcatgcaaaatcaagctttattttt |
18316463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University