View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5726_low_8 (Length: 397)
Name: NF5726_low_8
Description: NF5726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5726_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 2e-90; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 2e-90
Query Start/End: Original strand, 10 - 201
Target Start/End: Complemental strand, 26453706 - 26453517
Alignment:
| Q |
10 |
aagaatatgaggaatgagatgggatatatatggagtcttgtccatacatattggtatagttatgaagtttccttatatgcatatttagttttgcaaaact |
109 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26453706 |
aagaaaatgaggaatgagatgggatatatatggagtcttgtccatacat--tggtatagttatgaagtttccttatatgcatatttagttttgcaaaact |
26453609 |
T |
|
| Q |
110 |
ctaatatatatgaggaatctctcaatactatctcactatgatgttgaagaagacaatgttgtttgttttagcctctcttcaatgccatttag |
201 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26453608 |
ctaatatatatgaggaatctctcaataatatctcattatgatgttgaagaagacaatgttgtttgttttagcctctcttcaatgccatttag |
26453517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 196 - 355
Target Start/End: Complemental strand, 26453425 - 26453245
Alignment:
| Q |
196 |
atttagattgaattttatgtttgatattcttattgttttaatgactttcttaataatctttt---------------------attccttaacatatttc |
274 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
26453425 |
attttgattgaattttatgtttgatattcttattgttttaatggctttcttaataatcttttgcgctttccatttttttttttattccttaacatatttc |
26453326 |
T |
|
| Q |
275 |
aatgtttgatcttggcgaggtgaaggaatatgattggaattactgatcaagaagaagtctcaatattttcttcgatgagga |
355 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26453325 |
aatgtttgatcttggtgaggtgaaggaatatgattggaattactgatcaagaagaagtctcaatattttcttcgatgagga |
26453245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 352 - 381
Target Start/End: Complemental strand, 26452973 - 26452944
Alignment:
| Q |
352 |
aggattggagagagtaaatattagtgaact |
381 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
26452973 |
aggattggagagagtaaatattagtgaact |
26452944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University