View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5727-Insertion-7 (Length: 130)
Name: NF5727-Insertion-7
Description: NF5727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5727-Insertion-7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 64; Significance: 2e-28; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 64; E-Value: 2e-28
Query Start/End: Original strand, 8 - 75
Target Start/End: Complemental strand, 30413217 - 30413150
Alignment:
| Q |
8 |
ctctccacaccactaattgtgtcattagaattctgaagtggttccaatgatctcacaatcttttctat |
75 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30413217 |
ctctccacaccactaattgggtcattagaattctgaagtggttccaatgatctcacaatcttttctat |
30413150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.00000000000004
Query Start/End: Original strand, 25 - 128
Target Start/End: Complemental strand, 30412379 - 30412276
Alignment:
| Q |
25 |
tgtgtcattagaattctgaagtggttccaatgatctcacaatcttttctatgcttggtctatattttggtctttccgacagacattgaatcacaatgtga |
124 |
Q |
| |
|
|||||||| |||| ||||||| | |||| |||||||||||||| || ||| |||||||||||| |||| |||| |||||||||||||| | ||| ||| |
|
|
| T |
30412379 |
tgtgtcatcggaatgctgaagttgctccagtgatctcacaatctcttgtatttttggtctatattctggtttttcagacagacattgaattataatatga |
30412280 |
T |
|
| Q |
125 |
gcta |
128 |
Q |
| |
|
|||| |
|
|
| T |
30412279 |
gcta |
30412276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 28; E-Value: 0.0000006
Query Start/End: Original strand, 27 - 114
Target Start/End: Complemental strand, 30423531 - 30423444
Alignment:
| Q |
27 |
tgtcattagaattctgaagtggttccaatgatctcacaatcttttctatgcttggtctatattttggtctttccgacagacattgaat |
114 |
Q |
| |
|
||||||| |||| ||||||| ||||||| |||||||| | || || ||| |||||||||||||| || | ||||||||||| |||| |
|
|
| T |
30423531 |
tgtcattggaatcctgaagttgttccaacgatctcaccacctcgtcaatgtttggtctatatttttgttctgccgacagacatcgaat |
30423444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University