View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5727_low_5 (Length: 312)
Name: NF5727_low_5
Description: NF5727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5727_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 73 - 296
Target Start/End: Complemental strand, 48107255 - 48107032
Alignment:
| Q |
73 |
gagtttgatgattggattgattattagtactgattaacaaagaatcatcaataataatagtaattatcactcacaaaactaaagtgagaatttccagatc |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
48107255 |
gagtttgatgattggattgattattagtactgattaacaaagaatcatcaataataatagtaattatcactcacaaaactaaaatgagaatttccagatc |
48107156 |
T |
 |
| Q |
173 |
ttgattcgaagatccaccttacattctgagtcgataacagaagccaccgacggcgacttaccggcgggaacagttcctcgaattccttcacacgtcactc |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48107155 |
ttgattcgaagatccaccttacattctgagtcgataacagaagccaccgacggcgacttaccggcgggaacagttcctcgaattccttcacacgtcactc |
48107056 |
T |
 |
| Q |
273 |
taattccaactttcttactcttca |
296 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
48107055 |
taattccaactttcttactcttca |
48107032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 259 - 296
Target Start/End: Original strand, 7355201 - 7355238
Alignment:
| Q |
259 |
ttcacacgtcactctaattccaactttcttactcttca |
296 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7355201 |
ttcacacgtcactaaaattccaactttcttactcttca |
7355238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University