View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5727_low_6 (Length: 284)
Name: NF5727_low_6
Description: NF5727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5727_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 269
Target Start/End: Original strand, 35703065 - 35703349
Alignment:
| Q |
1 |
tccttttatcatttcaagcttttgcaaccatgcagatcttctgctgtatgtaattgtttggtcgcacaaaaacaagaa-----------gaagaattatg |
89 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||||||||| |||||||||||||||| ||||||||| ||||| |||||||| || |
|
|
| T |
35703065 |
tccttttatcatttgaagcttttgcaaccatgcaggtcttctgctctatgtaattgtttggttgcacaaaaataagaaatctaaagtgagaagaattctg |
35703164 |
T |
|
| Q |
90 |
gtgccttaa-----tttaatttaattttgtaaatgtaaactcaactaaggtgtatgaagcaggtgtagtgagctcttccatttagcgatttaactacttg |
184 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35703165 |
gtgccttaatttaatttaatttaattttgtaaatgtaaactcaactaaggtgtatgaagcaggtgtagtgagctcttccatttagcgatttaactacttg |
35703264 |
T |
|
| Q |
185 |
tgcattgaaaactacttatgcttttcagatactgggctttggcggtaccaacttatctgatggtgaccattgtattaatgttggt |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35703265 |
tgcattgaaaactacttatgcttttcagatactgggctttggcggtaccaacttatctgatggtgaccattgtattaatgttggt |
35703349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 193 - 268
Target Start/End: Original strand, 7957002 - 7957077
Alignment:
| Q |
193 |
aaactacttatgcttttcagatactgggctttggcggtaccaacttatctgatggtgaccattgtattaatgttgg |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
7957002 |
aaactacttatgcttttcagatactgggctttggcagtaccaacttatgtgatggtgaccattgtattaatgttgg |
7957077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 7 - 78
Target Start/End: Original strand, 7956810 - 7956881
Alignment:
| Q |
7 |
tatcatttcaagcttttgcaaccatgcagatcttctgctgtatgtaattgtttggtcgcacaaaaacaagaa |
78 |
Q |
| |
|
|||||||| ||||||| ||||||||||| || ||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
7956810 |
tatcatttgaagctttatcaaccatgcaggtcctctactgtatgtaattgtttggtgtcacaaaaacaagaa |
7956881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University