View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5728_high_5 (Length: 250)
Name: NF5728_high_5
Description: NF5728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5728_high_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 160; Significance: 2e-85; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 9 - 168
Target Start/End: Original strand, 4551640 - 4551799
Alignment:
| Q |
9 |
gaagaatattagtgatttagggaatggtttgttgggttttcaatgtctccaattttgaatgtttcttccaaattttgggttttttcttaatcgatacact |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4551640 |
gaagaatattagtgatttagggaatggtttgttgggttttcaatgtctccaattttgaatgtttcttccaaattttgggttttttcttaatcgatacact |
4551739 |
T |
|
| Q |
109 |
ggtggaaaacatgatatttattgatttctgcattgagttcgtgttatgtataatctgaag |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4551740 |
ggtggaaaacatgatatttattgatttctgcattgagttcgtgttatgtataatctgaag |
4551799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 198 - 232
Target Start/End: Original strand, 4551829 - 4551863
Alignment:
| Q |
198 |
ctcagaacgggcattggtgaggtttagttgttgat |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
4551829 |
ctcagaacgggcattggtgaggtttagttgttgat |
4551863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University