View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5728_low_3 (Length: 376)
Name: NF5728_low_3
Description: NF5728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5728_low_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 347; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 347; E-Value: 0
Query Start/End: Original strand, 1 - 367
Target Start/End: Original strand, 568642 - 569008
Alignment:
| Q |
1 |
tcatcagaggcttttcgttgttgggttggagacttggaaaacagctaccacttgtcaggttcagcggtgggaccacatccatgtcccaccatggtacgtg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
568642 |
tcatcagaggcttttcgttgttgggttggagacctggaaaacagctaccacttgtcaggttcagcggtgggaccacatccatgtcccaccatggtacgtg |
568741 |
T |
|
| Q |
101 |
agtttcagtcagtgattgggaaagaaacaaggaaacaagcatgggaaaaatggggaggaaaaccagacattattgttgcaagtgttggaacaggttcaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
568742 |
agtttcagtcagtgattgggaaagaaacaaggaaacaagcatgggaaaaatggggaggaaaaccagacattattgttgcaagtgttggaacaggttcaaa |
568841 |
T |
|
| Q |
201 |
tgctttaggtatgttccatgagtttctatcagacatagatgtgagattgattggagttgaagctgctggtttagggttagaaagtggaaaacattcttcc |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
568842 |
tgctttaggtatgttccatgagtttctatcagacacagatgtgagattgattggagttgaagctgctggtttagggttagaaagtggaaaacattcttcc |
568941 |
T |
|
| Q |
301 |
actttggccaaaggagaaatgggtgtttatcatggtgctatctcctatttattacaagatgatgatg |
367 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
568942 |
actttaaccaaaggagaaatgggtgtttatcatggtgctatctcctatttattacaagatggtgatg |
569008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 73 - 188
Target Start/End: Original strand, 20172427 - 20172542
Alignment:
| Q |
73 |
ccacatccatgtcccaccatggtacgtgagtttcagtcagtgattgggaaagaaacaaggaaacaagcatgggaaaaatggggaggaaaaccagacatta |
172 |
Q |
| |
|
|||||||||| ||| | |||||| | |||||||| ||||||| |||||||||||||| || ||||||| ||||||||||||||| || ||||| ||| |
|
|
| T |
20172427 |
ccacatccatatcctatgatggtaagagagtttcatgcagtgatagggaaagaaacaagaaagcaagcattggaaaaatggggagggaagccagatattc |
20172526 |
T |
|
| Q |
173 |
ttgttgcaagtgttgg |
188 |
Q |
| |
|
| || ||| ||||||| |
|
|
| T |
20172527 |
tagtagcatgtgttgg |
20172542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University