View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5728_low_7 (Length: 249)
Name: NF5728_low_7
Description: NF5728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5728_low_7 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 1 - 199
Target Start/End: Complemental strand, 26209724 - 26209526
Alignment:
| Q |
1 |
atgccacaaaaatataataagaaggacaaaccatggacatggtgaannnnnnnnnnnnnnatcaaatagtttggtagtaagaatttactctttaaaatga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26209724 |
atgccacaaaaatataataagaaggacaaaccatggacatggtgaatttttattttttttgtcaaatagtttggtagtaagaatttactctttaaaatga |
26209625 |
T |
 |
| Q |
101 |
ataaatgtgatgtttagggtttgaaattcaacccttatatataataatgtattgtccatactagcttaactatgttcgtggaacaaaaccatcgtgtac |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||| || | |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
26209624 |
ataaatgtgatgtttagggtttgaaattcaatccctgtatataataatgtattgtccatactagcttaactatgttcgtggaataaaaccatcgtgtac |
26209526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University