View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5729-Insertion-1 (Length: 108)
Name: NF5729-Insertion-1
Description: NF5729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5729-Insertion-1 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 73; Significance: 7e-34; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 73; E-Value: 7e-34
Query Start/End: Original strand, 8 - 108
Target Start/End: Original strand, 40969919 - 40970019
Alignment:
| Q |
8 |
catgtttggtataaaaatcaatcaaagagttacacacgacaacatcttgaacatatccacccttaacaaccaaaccatgtatctgtagagcttggtcgag |
107 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||| |
|
|
| T |
40969919 |
catgtttggtgtaaaaatcaatcaaagaggtacacacataaacatcttgaacatatccacccttaacaaccaaaccatgtatctgtagagctgggttgag |
40970018 |
T |
 |
| Q |
108 |
a |
108 |
Q |
| |
|
| |
|
|
| T |
40970019 |
a |
40970019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University