View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5729-Insertion-7 (Length: 146)

Name: NF5729-Insertion-7
Description: NF5729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5729-Insertion-7
NF5729-Insertion-7
[»] chr2 (1 HSPs)
chr2 (104-146)||(12805437-12805480)


Alignment Details
Target: chr2 (Bit Score: 36; Significance: 0.00000000001; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 104 - 146
Target Start/End: Complemental strand, 12805480 - 12805437
Alignment:
104 tgctttgattattctctataaagct-ttttctgtctttgttcct 146  Q
    ||||||||||||||||||||||||| ||||||||||||||||||    
12805480 tgctttgattattctctataaagcttttttctgtctttgttcct 12805437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University