View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5729_high_12 (Length: 269)
Name: NF5729_high_12
Description: NF5729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5729_high_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 14 - 268
Target Start/End: Original strand, 50453124 - 50453379
Alignment:
| Q |
14 |
aaattaaatagcataacatagacccaggnnnnnnnn-tagcataaaatggacggtacaaaccaggatatgactcggtgcttatccacaactcgtgtgtct |
112 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
50453124 |
aaattaaatagcataacatagacccagaaaaaaaaaatagcataaaatgaacggtacaaaccaggatatgactcggtgcttatccacaactcttgtgtct |
50453223 |
T |
 |
| Q |
113 |
agaaaatgatactacacgacaatgaccattttcaatttttcaccaatttcaatggaatggtttagtttctccttcgggatgccctggtaaacatatcttt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50453224 |
agaaaatgatactacacgacaatgaccattttcaatttttcaccaatttcaatggaatggtttagtttctccttcgggatgccctggtaaacatatcttt |
50453323 |
T |
 |
| Q |
213 |
gatgttatgtgattctgtctccactttcatcttctttgcttttctacccttcttca |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
50453324 |
gatgttatgtgattctgtctccactttcatcttctttgcttgtctacccttcttca |
50453379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University