View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5729_high_14 (Length: 251)
Name: NF5729_high_14
Description: NF5729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5729_high_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 7 - 238
Target Start/End: Complemental strand, 6652158 - 6651920
Alignment:
| Q |
7 |
taatttagggactactatctttctatcggacaaatgaaagcctttctcaaagagggaacatgaacttgtttg-----tgacacaacattcatggaaaatc |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6652158 |
taatttagggactactatctttctatcggacaaatgaaagcctttctcaaagagggaacatgaacttgtttgaattgtgacacaacattcatggaaaatc |
6652059 |
T |
 |
| Q |
102 |
aagaaa--gtgttttcaaataatcttagttgtgaagatataaggatgcaatataagctgaccaaactacctattgtaaaaaatattgaaattgggatatt |
199 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6652058 |
aagaaaaagtgttttcaaataatcttagttgtgaagatataaggatgcaatataagctgaccaaactacctattgtaaaaaatattgaaattgggatatt |
6651959 |
T |
 |
| Q |
200 |
ttagttttgggtaaatcaaggtatatatcaatactagta |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6651958 |
ttagttttgggtaaatcaaggtatatatcaatactagta |
6651920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University