View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5729_high_19 (Length: 227)
Name: NF5729_high_19
Description: NF5729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5729_high_19 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 159; Significance: 8e-85; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 6 - 227
Target Start/End: Complemental strand, 7187463 - 7187248
Alignment:
| Q |
6 |
aaggagaacgttgtagcgtttgttgaagttgaaaattggagttagggttaatggtattgatggtgtgtaactgttgttgatcttgagagagagatggtga |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7187463 |
aaggagaacgttgtagcgtttgttgaagttgaaaattggagttagggttaatggtattgatggtgtgtaactgttgttgatcttgagagagagatggtga |
7187364 |
T |
|
| Q |
106 |
tgaatttgacatgtgaattgaaggagannnnnnnnnnnnnnnnnnagagattggtgaaggagatgggattgaagggtttgaagaagaggggttctgaatt |
205 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7187363 |
tgaatttgacatgtgaattgaaggaga------ttgttgttgttgagagattggtgaaggagatgggattgaagggtttgaagaagaggggttctgaatt |
7187270 |
T |
|
| Q |
206 |
tgagaatccggtgaatcaatta |
227 |
Q |
| |
|
||||||||||||||| |||||| |
|
|
| T |
7187269 |
tgagaatccggtgaaccaatta |
7187248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 155 - 207
Target Start/End: Complemental strand, 7181532 - 7181480
Alignment:
| Q |
155 |
attggtgaaggagatgggattgaagggtttgaagaagaggggttctgaatttg |
207 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |||||| ||| |||| |
|
|
| T |
7181532 |
attggtgaaggagatgggattgtagggtttgaagaaatggggttttgagtttg |
7181480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University