View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5729_high_4 (Length: 448)
Name: NF5729_high_4
Description: NF5729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5729_high_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 428; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 428; E-Value: 0
Query Start/End: Original strand, 1 - 440
Target Start/End: Complemental strand, 40107345 - 40106906
Alignment:
| Q |
1 |
tctaataatcatattagtagaattactaaaatggttgattatgtttcgtctctcggaacttacttgggttgcgtcgaaggcttcaatttccacgcttttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
40107345 |
tctaataatcatattagtagaattactaaaatggttgattatgtttcgtctctcggaacttacttgggttgcgtcgaaggcttcgatttccacgcttttc |
40107246 |
T |
 |
| Q |
101 |
ctactctgaaccagctttcattagtttctgaacagcaactaagagacgctggttttggttacaggttagtttaggtttagttccttcaataactgttatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40107245 |
ctactctgaaccagctttcattagtttctgaacagcaactaagagacgctggttttggttacaggttagtttaggtttagttccttcaataactgttatt |
40107146 |
T |
 |
| Q |
201 |
agtttcgtgtgaatgttaacgtggttactattttcttgatagggctaagtatataactggcactgtgaatgttttgcaatcaaaacctgaaggtggggaa |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40107145 |
agtttcgtgtgaatgttaacgtggttactattttcttgatagggctaagtatataactggcactgtgaatgttttgcaatcaaaacctgaaggtggggaa |
40107046 |
T |
 |
| Q |
301 |
gaatggctttattctcttcgcaaattggagcttgaagatgtaatatctgaactcatcaagttacctggagtgggtcctaaagtggctgcttgtatagctc |
400 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40107045 |
gaatggctttattctcttcgcaaattggagcttgaagatgtaatatccgaactcatcaagttacctggagtgggtcctaaagtggctgcttgtatagctc |
40106946 |
T |
 |
| Q |
401 |
tttactcacttgatcaacaccatgcaattcctgatgatgt |
440 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
40106945 |
tttactcacttgatcaacaccatgcaattcctgttgatgt |
40106906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University