View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5729_low_5 (Length: 421)
Name: NF5729_low_5
Description: NF5729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5729_low_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 46; Significance: 4e-17; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 332 - 381
Target Start/End: Original strand, 28873024 - 28873073
Alignment:
| Q |
332 |
aaatgcacggtgaatttgtggctacaattttatttaaaaatgacacaaga |
381 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28873024 |
aaatgcatggtgaatttgtggctacaattttatttaaaaatgacacaaga |
28873073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University