View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5729_low_5 (Length: 421)

Name: NF5729_low_5
Description: NF5729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5729_low_5
NF5729_low_5
[»] chr2 (1 HSPs)
chr2 (332-381)||(28873024-28873073)


Alignment Details
Target: chr2 (Bit Score: 46; Significance: 4e-17; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 332 - 381
Target Start/End: Original strand, 28873024 - 28873073
Alignment:
332 aaatgcacggtgaatttgtggctacaattttatttaaaaatgacacaaga 381  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||    
28873024 aaatgcatggtgaatttgtggctacaattttatttaaaaatgacacaaga 28873073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University