View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5730_low_17 (Length: 238)

Name: NF5730_low_17
Description: NF5730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5730_low_17
NF5730_low_17
[»] chr8 (1 HSPs)
chr8 (1-223)||(3954803-3955025)


Alignment Details
Target: chr8 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 3955025 - 3954803
Alignment:
1 tggtgcaaaagctttctcattgttgagaacaaaatggaaattgaattcaccaaacactcttttaaccttttcttcttctttttcatcttcacatcacgcc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3955025 tggtgcaaaagctttctcattgttgagaacaaaatggaaattgaattcaccaaacactcttttaaccttttcttcttctttttcatcttcacatcacgcc 3954926  T
101 aagttcaaagctccaatggatatggctgcaagagatggcgaatttagggtttttattgttgccggcgaggtttccggtgattccatcgcttctcgtctta 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
3954925 aagttcaaagctccaatggatatggctgcaagagatggcgaatttagggtttttgttgttgccggcgaggtttccggtgattccatcgcttctcgtctta 3954826  T
201 tggcttctcttaagcttctctct 223  Q
    |||||||||||||||||||||||    
3954825 tggcttctcttaagcttctctct 3954803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University