View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5731-Insertion-1 (Length: 156)
Name: NF5731-Insertion-1
Description: NF5731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5731-Insertion-1 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 126; Significance: 3e-65; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 126; E-Value: 3e-65
Query Start/End: Original strand, 7 - 156
Target Start/End: Original strand, 36240344 - 36240492
Alignment:
| Q |
7 |
agtatcaatatgactaagtttattaattaacatggttaatcaaaagatgcatgctatgttgattaaggatagacatactagttggctatatgggaattaa |
106 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||||||| ||| ||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36240344 |
agtaacaatatgactaagtttattaattaacatgtttaatcaaa-gatacatgctatgttgattaaggatagacatacaagttggctatatgggaattaa |
36240442 |
T |
 |
| Q |
107 |
ttatagagtatagactaaatcaagaaacaggttgtttgatgtagtaggga |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36240443 |
ttatagagtatagactaaatcaagaaacaggttgtttgatgtagtaggga |
36240492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University