View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5731_high_13 (Length: 252)
Name: NF5731_high_13
Description: NF5731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5731_high_13 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 12 - 252
Target Start/End: Complemental strand, 3338425 - 3338182
Alignment:
| Q |
12 |
atgaagaggaggaggg-ttgtgggatccaccatgagtgcattggatggagcatannnnnnnnnnnn--gccgacaaagggcatctttggatgcatgggtt |
108 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3338425 |
atgaagaggaggaggggttgtggggtccaccatgagtgcattggatggagcataagagagagagagaggccgacaaagggcatctttggatgcatgggtt |
3338326 |
T |
 |
| Q |
109 |
ttagtatttgcgcacgcacgggagttgttattctcaatatatatcaatgacttgtgattaatatcatattattatcactaattaattttaggtaggtttc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3338325 |
ttagtatttgcgcacgcacgggagttgttattctcaatatatatcaatgacttgtgattaatatcatattattatcactaattaattttaggtaggtttc |
3338226 |
T |
 |
| Q |
209 |
agagatttcagagtaattcagctaactcttcggtgctttccact |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3338225 |
agagatttcagagtaattcagctaactcttcggtgctttccact |
3338182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University