View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5731_high_17 (Length: 206)
Name: NF5731_high_17
Description: NF5731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5731_high_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 10 - 190
Target Start/End: Complemental strand, 3338124 - 3337944
Alignment:
| Q |
10 |
agcagcacagatctggattatgcggtcaaccccatgccaacttaactacactctgtactctttctttctccatccattatatgcaccaaacctcaccaac |
109 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3338124 |
agcaacactgatctggattatgcggtcaaccccatgccaacttaactacactctgtactctttctttctccatccattatatgcaccaaacctcaccaac |
3338025 |
T |
 |
| Q |
110 |
aaatatcaacacttcatcgtctcaattataacaagtcaattaggcacctgtgattaataaataacttgtttatcatgttat |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3338024 |
aaatatcaacacttcatcgtctcaattataacaagtcaattaggcacctgtgattaataaataacttgtttatcatgttat |
3337944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University