View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5731_low_17 (Length: 221)
Name: NF5731_low_17
Description: NF5731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5731_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 17 - 205
Target Start/End: Original strand, 36952477 - 36952665
Alignment:
| Q |
17 |
tatacatacactcactctctcataatatttctatccaccacctgctcctttaatcacacaaaaatgttcactccatctcttcaaattttctcactaaann |
116 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36952477 |
tatacatacacccactctctcataatatttctatccaccacctgctcctttaatcacacaaaaatgttcactccatctcttcaaattttctcactaaaat |
36952576 |
T |
|
| Q |
117 |
nnnnnnnnnnnnnnnnttcaaatttaacctcaatcaaactcaaaagaattatccacaccctcttagtttcacacttgtgtagaataatt |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36952577 |
catcatcatcatcatcttcaaatttaacctcaatcaaactcaaaagaattatccacaccctcttagtttcacacttgtgtagaataatt |
36952665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University