View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5732-Insertion-1 (Length: 143)
Name: NF5732-Insertion-1
Description: NF5732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5732-Insertion-1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 99; Significance: 3e-49; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 99; E-Value: 3e-49
Query Start/End: Original strand, 8 - 118
Target Start/End: Complemental strand, 36726863 - 36726754
Alignment:
| Q |
8 |
ccttgatgaccttaacattccttccatcctaggtggtttgattttcctttgggaatctccaacattctcactcaagcaaagcatatttgtcaccctaaca |
107 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36726863 |
ccttgatgaccttaacatttcttccatcctaggtggtttg-ttttcctttgggaatctccaacattctcactcaagcaaagcatatttgtcaccctaaca |
36726765 |
T |
 |
| Q |
108 |
tatttttctac |
118 |
Q |
| |
|
||||||||||| |
|
|
| T |
36726764 |
tatttttctac |
36726754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University