View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5732-Insertion-5 (Length: 143)
Name: NF5732-Insertion-5
Description: NF5732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5732-Insertion-5 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 75; Significance: 6e-35; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 75; E-Value: 6e-35
Query Start/End: Original strand, 12 - 135
Target Start/End: Original strand, 26210050 - 26210176
Alignment:
| Q |
12 |
agtaagataagggcaactttgtc-aagtgagtagaaac-aagccc-acatggcaaagggatacactcaaaattgaaaaaatcatgttagcctgtttgact |
108 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||| |||| | |||||||||||||||||||||||||||||| |||| |||||||| ||||||||| |
|
|
| T |
26210050 |
agtaagataagggcaactttgtccaagtgagtaggaaccaagcactacatggcaaagggatacactcaaaattgaataaataatgttagcttgtttgact |
26210149 |
T |
|
| Q |
109 |
attttaatttatcttgattataaataa |
135 |
Q |
| |
|
|||||| |||||||||||||| ||||| |
|
|
| T |
26210150 |
attttagtttatcttgattattaataa |
26210176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University