View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5733-Insertion-6 (Length: 164)
Name: NF5733-Insertion-6
Description: NF5733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5733-Insertion-6 |
 |  |
|
| [»] chr2 (4 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 118; Significance: 2e-60; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 6 - 164
Target Start/End: Complemental strand, 40030497 - 40030339
Alignment:
| Q |
6 |
cagaatctacaacttgtatatttctaaaatatgaagcttttccataaccctcttctggaaaatatccactacccatttgggttgttgtgtgagacccnnn |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
40030497 |
cagaatctacaacttgtatatttctaaaatatgaagcttttccataaccctcatctggaaaatgtccactacccatttgggttgttgtgtgagacccttt |
40030398 |
T |
 |
| Q |
106 |
nnnngttgtaaacacttctccaccaaaatctatatgagttgcaccatcatttaaatgtg |
164 |
Q |
| |
|
|||||| |||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
40030397 |
ttttgttgtagacacttctccaccaaaatctatatcagttgcaccatcatttaagtgtg |
40030339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 14 - 89
Target Start/End: Original strand, 30905669 - 30905744
Alignment:
| Q |
14 |
acaacttgtatatttctaaaatatgaagcttttccataaccctcttctggaaaatatccactacccatttgggttg |
89 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||| | ||| ||| |||| ||||| |||||||||||||||||||| |
|
|
| T |
30905669 |
acaacttgcatattcttaaaatatgaagcttttgaagaacgctcatctgcaaaatgtccactacccatttgggttg |
30905744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 14 - 89
Target Start/End: Original strand, 30916372 - 30916447
Alignment:
| Q |
14 |
acaacttgtatatttctaaaatatgaagcttttccataaccctcttctggaaaatatccactacccatttgggttg |
89 |
Q |
| |
|
|||||||||| ||| |||||| |||||||||| | ||||||| |||| ||||| |||||||||||||||||||| |
|
|
| T |
30916372 |
acaacttgtaaattcctaaaaagtgaagcttttgaaaaaccctcatctgcaaaatgtccactacccatttgggttg |
30916447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 14 - 89
Target Start/End: Original strand, 30925505 - 30925580
Alignment:
| Q |
14 |
acaacttgtatatttctaaaatatgaagcttttccataaccctcttctggaaaatatccactacccatttgggttg |
89 |
Q |
| |
|
|||||||| |||| |||||||||||||||||| | ||||||| || | ||||| |||||||||||||||||||| |
|
|
| T |
30925505 |
acaacttgcatatccctaaaatatgaagcttttgaagaaccctcatcagcaaaatgtccactacccatttgggttg |
30925580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 60; Significance: 7e-26; HSPs: 7)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 60; E-Value: 7e-26
Query Start/End: Original strand, 14 - 89
Target Start/End: Complemental strand, 29255555 - 29255480
Alignment:
| Q |
14 |
acaacttgtatatttctaaaatatgaagcttttccataaccctcttctggaaaatatccactacccatttgggttg |
89 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||| | ||||| |||||||||||||||||||| |
|
|
| T |
29255555 |
acaacttgcatatttctaaaatatgaagcttttccataaccctcttcagcaaaatgtccactacccatttgggttg |
29255480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 7 - 89
Target Start/End: Complemental strand, 29248935 - 29248853
Alignment:
| Q |
7 |
agaatctacaacttgtatatttctaaaatatgaagcttttccataaccctcttctggaaaatatccactacccatttgggttg |
89 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||||||||||||||||| || | ||||| |||||||||||||||||||| |
|
|
| T |
29248935 |
agaacctacaacttgcatatttctaaaatatgaagcttttccataaccctcctcagcaaaatgtccactacccatttgggttg |
29248853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 49; E-Value: 2e-19
Query Start/End: Original strand, 6 - 98
Target Start/End: Original strand, 29211107 - 29211199
Alignment:
| Q |
6 |
cagaatctacaacttgtatatttctaaaatatgaagcttttccataaccctcttctggaaaatatccactacccatttgggttgttgtgtgag |
98 |
Q |
| |
|
||||||| |||||||| ||||| ||||| |||| ||||||| || |||||||||| | ||||| |||||||||||||||||||| |||||||| |
|
|
| T |
29211107 |
cagaatccacaacttgcatattcctaaagtatgcagcttttgcaaaaccctcttcagcaaaatgtccactacccatttgggttgatgtgtgag |
29211199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 16 - 98
Target Start/End: Complemental strand, 29228167 - 29228085
Alignment:
| Q |
16 |
aacttgtatatttctaaaatatgaagcttttccataaccctcttctggaaaatatccactacccatttgggttgttgtgtgag |
98 |
Q |
| |
|
||||||||||||||||| |||||| ||||||| | ||||||| || | ||||| |||||| ||||||||||||| ||||||| |
|
|
| T |
29228167 |
aacttgtatatttctaatatatgacgcttttctaaaaccctcctcggcaaaatgtccactccccatttgggttgacgtgtgag |
29228085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 30 - 87
Target Start/End: Complemental strand, 29236058 - 29236001
Alignment:
| Q |
30 |
taaaatatgaagcttttccataaccctcttctggaaaatatccactacccatttgggt |
87 |
Q |
| |
|
||||||||| ||||||||||||| ||| || | ||||| |||||||||||||||||| |
|
|
| T |
29236058 |
taaaatatgcagcttttccataattctcctcagcaaaatgtccactacccatttgggt |
29236001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 30 - 87
Target Start/End: Complemental strand, 29280791 - 29280734
Alignment:
| Q |
30 |
taaaatatgaagcttttccataaccctcttctggaaaatatccactacccatttgggt |
87 |
Q |
| |
|
||||||||| ||||||||||||| ||| || | ||||| |||||||||||||||||| |
|
|
| T |
29280791 |
taaaatatgcagcttttccataattctcctcagcaaaatgtccactacccatttgggt |
29280734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 8 - 87
Target Start/End: Complemental strand, 29367589 - 29367510
Alignment:
| Q |
8 |
gaatctacaacttgtatatttctaaaatatgaagcttttccataaccctcttctggaaaatatccactacccatttgggt |
87 |
Q |
| |
|
|||||||||||| ||||| ||||||||| |||||||| | ||||||| || || || | |||||||||||||||||| |
|
|
| T |
29367589 |
gaatctacaactccaatattcttaaaatatgcagcttttctaaaaccctcatcaggcaagtgtccactacccatttgggt |
29367510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University