View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5733-Insertion-7 (Length: 148)
Name: NF5733-Insertion-7
Description: NF5733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5733-Insertion-7 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 130; Significance: 1e-67; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 130; E-Value: 1e-67
Query Start/End: Original strand, 7 - 148
Target Start/End: Original strand, 38357375 - 38357516
Alignment:
| Q |
7 |
aaagggacctttggagaaccttgctgatcatcttgccgacccagtcaacaacaacgcatgggcctatgccaccaactttgttcccggaaagtgaatggtc |
106 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38357375 |
aaagggacctttggagaaccttgccgatcatcttgccgacccagtcaacaacaacgcatgggcctatgccaccaactttgttcccggaaagtgaatggtc |
38357474 |
T |
|
| Q |
107 |
attatgttttttgtgatgtatactttcttgtaatgttcttcc |
148 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
38357475 |
attatgttttttgttatgtatactttcttgtaacgttcttcc |
38357516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 46; Significance: 1e-17; HSPs: 6)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 46; E-Value: 1e-17
Query Start/End: Original strand, 7 - 100
Target Start/End: Original strand, 13276286 - 13276379
Alignment:
| Q |
7 |
aaagggacctttggagaaccttgctgatcatcttgccgacccagtcaacaacaacgcatgggcctatgccaccaactttgttcccggaaagtga |
100 |
Q |
| |
|
||||||||||||||| ||||||||||| || || || ||||| |||||||||||||| ||||||| ||| || |||||||||| ||||||||| |
|
|
| T |
13276286 |
aaagggacctttggaaaaccttgctgaccacctcgcagacccggtcaacaacaacgcttgggcctttgctacaaactttgttcttggaaagtga |
13276379 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 42; E-Value: 0.000000000000003
Query Start/End: Original strand, 11 - 100
Target Start/End: Original strand, 3573059 - 3573148
Alignment:
| Q |
11 |
ggacctttggagaaccttgctgatcatcttgccgacccagtcaacaacaacgcatgggcctatgccaccaactttgttcccggaaagtga |
100 |
Q |
| |
|
|||||| | ||||| |||||||| || ||||| |||||||| |||||||| ||||||||||||||||| ||||||| || ||||||||| |
|
|
| T |
3573059 |
ggacctatagagaatcttgctgaccaccttgctgacccagttaacaacaatgcatgggcctatgccacaaactttgcccctggaaagtga |
3573148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 42; E-Value: 0.000000000000003
Query Start/End: Original strand, 7 - 100
Target Start/End: Original strand, 3576339 - 3576432
Alignment:
| Q |
7 |
aaagggacctttggagaaccttgctgatcatcttgccgacccagtcaacaacaacgcatgggcctatgccaccaactttgttcccggaaagtga |
100 |
Q |
| |
|
|||||||||| | ||||||||||| || ||| | | ||||| |||||||||||||| ||||||| |||||| |||||||| |||||||||||| |
|
|
| T |
3576339 |
aaagggacctctagagaaccttgccgaccatatcactgaccccgtcaacaacaacgcttgggcctttgccacaaactttgtccccggaaagtga |
3576432 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 42; E-Value: 0.000000000000003
Query Start/End: Original strand, 7 - 100
Target Start/End: Original strand, 3578195 - 3578288
Alignment:
| Q |
7 |
aaagggacctttggagaaccttgctgatcatcttgccgacccagtcaacaacaacgcatgggcctatgccaccaactttgttcccggaaagtga |
100 |
Q |
| |
|
||||||||| | |||||||||||||| || | || || |||||||||| |||||| ||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
3578195 |
aaagggaccactagagaaccttgctgaccacatcgctgatccagtcaacagcaacgcttgggcctttgccacaaactttgttcccggaaagtga |
3578288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 7 - 101
Target Start/End: Complemental strand, 3584879 - 3584785
Alignment:
| Q |
7 |
aaagggacctttggagaaccttgctgatcatcttgccgacccagtcaacaacaacgcatgggcctatgccaccaactttgttcccggaaagtgaa |
101 |
Q |
| |
|
|||||||||||| | ||||||||||| || | || |||||||| ||||||||||| ||||||| ||||| |||||||| ||||||||||||| |
|
|
| T |
3584879 |
aaagggacctttaaaaaaccttgctgaccacatcgctgacccagttaacaacaacgcttgggccttcgccacaaactttgtccccggaaagtgaa |
3584785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 7 - 86
Target Start/End: Original strand, 3570008 - 3570087
Alignment:
| Q |
7 |
aaagggacctttggagaaccttgctgatcatcttgccgacccagtcaacaacaacgcatgggcctatgccaccaactttg |
86 |
Q |
| |
|
|||||||||| | |||||||| ||||| || ||||| || ||||| |||||||| || |||||||||||||| ||||||| |
|
|
| T |
3570008 |
aaagggacctattgagaacctcgctgaccaccttgctgatccagttaacaacaatgcttgggcctatgccacaaactttg |
3570087 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University