View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5733-Insertion-8 (Length: 147)
Name: NF5733-Insertion-8
Description: NF5733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5733-Insertion-8 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 142; Significance: 7e-75; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 142; E-Value: 7e-75
Query Start/End: Original strand, 2 - 147
Target Start/End: Complemental strand, 39266342 - 39266197
Alignment:
| Q |
2 |
ccaacatcatgttggtaaatctcacatttcttaactttcatttagtgttctttgtgatttatcatgtttatcaaaatgtcgggcaacatttggaacgtat |
101 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39266342 |
ccaatatcatgttggtaaatctcacatttcttaactttcatttagtgttctttgtgatttatcatgtttatcaaaatgtcgggcaacatttggaacgtat |
39266243 |
T |
 |
| Q |
102 |
ctaatattatgttaggattaaagcagagttccatcaaataaggact |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39266242 |
ctaatattatgttaggattaaagcagagttccatcaaataaggact |
39266197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University