View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5733_high_7 (Length: 279)
Name: NF5733_high_7
Description: NF5733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5733_high_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 53; Significance: 2e-21; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 71 - 147
Target Start/End: Complemental strand, 26570507 - 26570431
Alignment:
| Q |
71 |
ttgcttccatttaaagtcatttaggcccgcttccataaattctcgttcttcttcttttgttttatataatgacacac |
147 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||| || || | ||||||||| |||||||||||||| |
|
|
| T |
26570507 |
ttgcttctatttaaagtcatttaggcccgcttccataaattctcattgttttgcttttgtttcatataatgacacac |
26570431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 11 - 75
Target Start/End: Complemental strand, 26570617 - 26570553
Alignment:
| Q |
11 |
atatagtagaactctagtacaacatcatgcatgcataaagattaacccatgcatgcttacttgct |
75 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| | |||||||||||| |||||||| |
|
|
| T |
26570617 |
atatagtagaactctagtacaatatcatgcatgcataaagactgacccatgcatgcctacttgct |
26570553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 219 - 272
Target Start/End: Complemental strand, 30760481 - 30760428
Alignment:
| Q |
219 |
tcaccatggctctcattgttcaaataattgtcatcattagtgtattcggatcct |
272 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
30760481 |
tcaccatggctctcggtgttcaaataattgtcatcattagtgtgttcggatcct |
30760428 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University