View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5733_high_8 (Length: 245)
Name: NF5733_high_8
Description: NF5733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5733_high_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 17 - 203
Target Start/End: Original strand, 40030490 - 40030676
Alignment:
| Q |
17 |
agattctgataacaagtttattccgttgccaaatgtcaaatatcaggcagagcacccaaactgttataatataattggaggagttagtaaccagggtgat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
40030490 |
agattctgataacaagtttattccgttgccaaatgtcaaatatcaggcggagcacccaaactgttataatataattggaggagttagtaaccagggtcag |
40030589 |
T |
 |
| Q |
117 |
aatttcttttactatggtggacctggaaagaatgtaaactgtccctaattcaaaattcgagttataaaggtcaacatttgtttttat |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40030590 |
aatttcttttactatggtggacctggaaagaatgtaaactgtccctaattcaaaattcgagttataaaggtcaacatttgtttttat |
40030676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 117 - 149
Target Start/End: Complemental strand, 30925407 - 30925375
Alignment:
| Q |
117 |
aatttcttttactatggtggacctggaaagaat |
149 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
30925407 |
aattacttttactatggtggacctggaaagaat |
30925375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 122 - 166
Target Start/End: Original strand, 29255661 - 29255705
Alignment:
| Q |
122 |
cttttactatggtggacctggaaagaatgtaaactgtccctaatt |
166 |
Q |
| |
|
||||||||||||||||||||||| |||| | || ||||||||||| |
|
|
| T |
29255661 |
cttttactatggtggacctggaaggaatatgaaatgtccctaatt |
29255705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University