View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5733_low_7 (Length: 310)
Name: NF5733_low_7
Description: NF5733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5733_low_7 |
 | |
|
| [»] chr5 (3 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 238; Significance: 1e-132; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 13 - 310
Target Start/End: Complemental strand, 40180366 - 40180069
Alignment:
| Q |
13 |
gagaaatggaaaagaaacccaaactgggggctagcgttagataggatgttaccccatagaatatttgagtttggcacactttgttcaagaaaagaaactg |
112 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
40180366 |
gagaaacggaaaagaaacccaaactgggggctagagttagataggctgttaccccatagaatatttgagtttgacacactttgttcaagaaaagaaactg |
40180267 |
T |
|
| Q |
113 |
tatatttggctttggatttgttgactgttattgatttccctcaggaggtggagcaccaggaagaggggactaaactattgcactgtcggcaggttattac |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| | |||||||||||||| ||||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
40180266 |
tatatttggctttggatttgttgactgttattgatatccataaggaggtggagcacaaggaagaggggactaaactatcgcactgtcggaaggttattac |
40180167 |
T |
|
| Q |
213 |
aggcttgtgtcggtttaaagattttgatgcagccaagcagttgatctttaaaatgattgcagacggtccgctaccgcgtccttcaaaatacgttttca |
310 |
Q |
| |
|
|| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| | ||||||| |
|
|
| T |
40180166 |
agccttgtgtcagtttaaagattttgatgcagccaagcagttgatctttaaaatgattgcagacggtccgctacagcgtccttcaaaagaagttttca |
40180069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 216 - 287
Target Start/End: Complemental strand, 38604671 - 38604600
Alignment:
| Q |
216 |
cttgtgtcggtttaaagattttgatgcagccaagcagttgatctttaaaatgattgcagacggtccgctacc |
287 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||| ||||||||||||||||| | ||| ||||||||||| |
|
|
| T |
38604671 |
cttgtgtcggtttgaagatttcgatgcagccaagcaattgatctttaaaatgatagaagatggtccgctacc |
38604600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 90 - 122
Target Start/End: Complemental strand, 38604797 - 38604765
Alignment:
| Q |
90 |
actttgttcaagaaaagaaactgtatatttggc |
122 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
38604797 |
actttgttcaaaaaaagaaactgtatatttggc |
38604765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 216 - 276
Target Start/End: Original strand, 44460734 - 44460794
Alignment:
| Q |
216 |
cttgtgtcggtttaaagattttgatgcagccaagcagttgatctttaaaatgattgcagac |
276 |
Q |
| |
|
||||||| ||||||||||||| || ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
44460734 |
cttgtgtgggtttaaagatttcgaaacagccaagcagttgatccttaaaatgattgcagac |
44460794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 216 - 276
Target Start/End: Original strand, 44468267 - 44468327
Alignment:
| Q |
216 |
cttgtgtcggtttaaagattttgatgcagccaagcagttgatctttaaaatgattgcagac |
276 |
Q |
| |
|
||||||| ||||||||||||| || ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
44468267 |
cttgtgtgggtttaaagatttcgaaacagccaagcagttgatccttaaaatgattgcagac |
44468327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 216 - 276
Target Start/End: Complemental strand, 34501950 - 34501890
Alignment:
| Q |
216 |
cttgtgtcggtttaaagattttgatgcagccaagcagttgatctttaaaatgattgcagac |
276 |
Q |
| |
|
||||||| |||||||| |||| || ||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
34501950 |
cttgtgtgggtttaaaaatttagaagcagccaagaagttgatccttaaaatgattgcagac |
34501890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University