View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5734_low_12 (Length: 220)
Name: NF5734_low_12
Description: NF5734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5734_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 17 - 170
Target Start/End: Original strand, 37787424 - 37787577
Alignment:
| Q |
17 |
gagatgaaagaggaaaagaaccgaagaaaacaaattatgttgtaagaagtaattgagatcgcaaacaatatcttccagagaagaatttttcgatttgtaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
37787424 |
gagatgaaagaggaaaagaaccgaagaaaaaaaattatgttgtaagaagtaattgagatcgcaaacagtatcttcaagagaagaatttttcgatttgtaa |
37787523 |
T |
|
| Q |
117 |
attgttggagcaagtgagagagattaaataattgaaagtttatgtgtccatctt |
170 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37787524 |
attgttggagaaagtgagagagattaaataattgaaagtttatgtgtccatctt |
37787577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University