View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5736-Insertion-1 (Length: 52)
Name: NF5736-Insertion-1
Description: NF5736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5736-Insertion-1 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 46; Significance: 4e-18; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 46; E-Value: 4e-18
Query Start/End: Original strand, 7 - 52
Target Start/End: Original strand, 37188781 - 37188826
Alignment:
| Q |
7 |
aatttgaagctggaatcttatatattaagcttccaaaactcatcaa |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37188781 |
aatttgaagctggaatcttatatattaagcttccaaaactcatcaa |
37188826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 1e-17
Query Start/End: Original strand, 7 - 51
Target Start/End: Original strand, 37893683 - 37893727
Alignment:
| Q |
7 |
aatttgaagctggaatcttatatattaagcttccaaaactcatca |
51 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37893683 |
aatttgaagctggaatcttatatattaagcttccaaaactcatca |
37893727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University