View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5736_high_11 (Length: 280)
Name: NF5736_high_11
Description: NF5736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5736_high_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 263; Significance: 1e-147; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 1 - 263
Target Start/End: Original strand, 46215319 - 46215581
Alignment:
| Q |
1 |
cctcttagagatgcttcttctgctgaattttcaactccttatgatcatggtgctggccatattaatcctagaaaagctcttgatccaggtttattatatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46215319 |
cctcttagagatgcttcttctgctgaattttcaactccttatgatcatggtgctggccatattaatcctagaaaagctcttgatccaggtttattatatg |
46215418 |
T |
 |
| Q |
101 |
atatcgaacctcaagattactttgagtttctttgcacaaagaaactaagcccttcagaattagtagttttttctaaaaattcaaacagaaattgcaaaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46215419 |
atatcgaacctcaagattactttgagtttctttgcacaaagaaactaagcccttcagaattagtagttttttctaaaaattcaaacagaaattgcaaaca |
46215518 |
T |
 |
| Q |
201 |
cactcttgctagtgctagtgacttgaactatcctgctatatcagttgtgattccagcaaaacc |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46215519 |
cactcttgctagtgctagtgacttgaactatcctgctatatcagttgtgattccagcaaaacc |
46215581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 86; Significance: 4e-41; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 15 - 169
Target Start/End: Complemental strand, 366674 - 366516
Alignment:
| Q |
15 |
ttcttctgctgaattttcaactccttatgatcatggtgctggcc----atattaatcctagaaaagctcttgatccaggtttattatatgatatcgaacc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| | |||||| ||||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
366674 |
ttcttctgctgaattttcaactccttatgatcatggtgctggacctatttattaaacctagaaaagctcttgatccaggtttagtatatgatattaaacc |
366575 |
T |
 |
| Q |
111 |
tcaagattactttgagtttctttgcacaaagaaactaagcccttcagaattagtagttt |
169 |
Q |
| |
|
||||||||| | |||||| |||||||||||||| |||| ||||||||| ||| ||||| |
|
|
| T |
366574 |
acaagattacatcgagtttatttgcacaaagaaagtaagtccttcagaaataggagttt |
366516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University