View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5736_low_10 (Length: 280)
Name: NF5736_low_10
Description: NF5736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5736_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 13 - 265
Target Start/End: Complemental strand, 43485362 - 43485106
Alignment:
| Q |
13 |
aaaataatctcatgtatatgtttgaggagtaattaatgaccatcactgtggtcacnnnnnnnnnnnnnnn---ctttcttaataataatcacttttaaat |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43485362 |
aaaataatctcatgtatatgtttgaggagtaattaatgaccatcactgtggtcacaaaaaaaaaaaaaaaaaactttcttaataataatcacttttaaat |
43485263 |
T |
 |
| Q |
110 |
tctgaatttttt-gttgttgtgtacttggtgactttattttagttaactttacgtactctcgcattttggtgtgcttttattttgagtctatctacaaat |
208 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
43485262 |
tctgaatttttttgttgttgtgtacttggtgactttattttagttaactttacgtactctcgcattttggagtgcttttattttgagtctatctacaaat |
43485163 |
T |
 |
| Q |
209 |
tgaagaaaaggactacacttttaattcgtatataaaattgaaatatgtgcaaagggt |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
43485162 |
tgaagaaaaggactacacttttaattcgtatataaaattgaaatatgtgtaaagggt |
43485106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University