View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5736_low_16 (Length: 239)
Name: NF5736_low_16
Description: NF5736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5736_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 17 - 223
Target Start/End: Complemental strand, 6287249 - 6287048
Alignment:
| Q |
17 |
tattgattttaaaataaggtgaccaactccataaagtggtgacggtttccaaaccaaaatgttatttatttannnnnnnn--gcaattttatttgtgact |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
6287249 |
tattgattttaaaataaggtgaccaactccataaagtggtgacggtttccaaaccaaaatgttattttttttatttttttttgcaattttatttgtgact |
6287150 |
T |
|
| Q |
115 |
tttcaaataaaggtattactttcgaaatagtggaaagcatctcgtaggttttgatcccatgagttatatgttggatttatttagagctattgctctcata |
214 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6287149 |
tttcaaataaaggt-------tcgaaatagtggaaagcatctcgtaggttttgatcccatgagttatatgttggatttatttagagctattgctctcata |
6287057 |
T |
|
| Q |
215 |
catgcttac |
223 |
Q |
| |
|
||||||||| |
|
|
| T |
6287056 |
catgcttac |
6287048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University