View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5736_low_19 (Length: 238)
Name: NF5736_low_19
Description: NF5736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5736_low_19 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 2 - 238
Target Start/End: Original strand, 6718955 - 6719194
Alignment:
| Q |
2 |
atatactatgtgtgtttactccaacttttaaaattcacggtggaagaattcttaattcacggtcgcagctgcccccaccaaatacattctatgactnnnn |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6718955 |
atatactatgtgtgtttactccaacttttaaaattcacggtggaagaattcttaattcacggtcgcagctgcccccaccaaatacattctatgactaaaa |
6719054 |
T |
 |
| Q |
102 |
nnnnntaaacaaatctttaaggttgttacctgttgatttactactattatttgacaaaaacttgaaatttaccggcaaacttgtttttaaaaactagttt |
201 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6719055 |
aaaaataaacaaatttttaaggttgttacctgttgatttactactattatttgacaaaaacttgaaatttaccggcaaacttgtttttaaaaactagttt |
6719154 |
T |
 |
| Q |
202 |
at---ccagatgagacatcaataaaaaggtttattattac |
238 |
Q |
| |
|
|| ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
6719155 |
atccaccagatgggacatcaataaaaaggtttattattac |
6719194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University