View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5736_low_4 (Length: 361)
Name: NF5736_low_4
Description: NF5736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5736_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 175; Significance: 4e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 175; E-Value: 4e-94
Query Start/End: Original strand, 20 - 242
Target Start/End: Original strand, 52594385 - 52594606
Alignment:
| Q |
20 |
aagtaaacactaaacagccactttcgtccttgaaaatgataagaggtatcaaaaaggctccctatcnnnnnnnnnnnntacttataaactcctcaaattt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
52594385 |
aagtaaacactaaacagccactttcgtccttgaaaatgataagaggtatcaaaaaggctccctatcaaaaataaaaaatacttataagctcctcaaattt |
52594484 |
T |
 |
| Q |
120 |
agcttttgttgggtatattggttgagacgttaaaatagtgttaattcaaggtcaaatatttgttaccaaacaacatgcatatgccgcaagtttccattgt |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
52594485 |
agcttttgttgggtatattggttgagacgttaaaatagtgttaattcaaggtcaaatatttgttaccaaac-acatgcatatgccgcaagtttccattgt |
52594583 |
T |
 |
| Q |
220 |
aactaacatgcaaattcaaggaa |
242 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
52594584 |
aactaacatgcaaattcaaggaa |
52594606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University