View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5736_low_9 (Length: 282)
Name: NF5736_low_9
Description: NF5736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5736_low_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 18 - 271
Target Start/End: Original strand, 29056027 - 29056286
Alignment:
| Q |
18 |
tctgatacttttttctccttata------tttgcagataatggatcttgtcatcaatcgatctttggttaaagagatagagcaagttattgatgaagatg |
111 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29056027 |
tctgatacttttttctccttataaatatatttgcagataatggatcttgtcatcaatcgatctttggttaaagagatagagcaagttattgatgaagatg |
29056126 |
T |
|
| Q |
112 |
gctctatcaaggactctgcggtttgttccatatctcgcacaagtttcctttttctaatcctacattatgacagttattacctgttggttttctttgattt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29056127 |
gctctatcaaggactctgcggtttgttccatatctcgcacaagtttcctttttctaatcctacattatgacagttattacctgttggttttctttgattt |
29056226 |
T |
|
| Q |
212 |
gagttggcatgggatttgttgcatcttggctctttttaatattcctcattacatagtatt |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29056227 |
gagttggcatgggatttgttgcatcttggctctttttaatattcctcattacatagtatt |
29056286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University