View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5737_low_1 (Length: 351)
Name: NF5737_low_1
Description: NF5737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5737_low_1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 215 - 331
Target Start/End: Complemental strand, 12674429 - 12674313
Alignment:
| Q |
215 |
ataaaaagtgcatgttttctatgcaacacgcaatcaatgtctttgactgtccttcttccttgtttctgcacattcaactccttcaattcaaataagtcca |
314 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
12674429 |
ataaaaagtgcatgtgttctatgcaacacgcaatcaatgtctttgactgtccttcttccttgtttctgcacattcaactccttcaattcaaataagtcga |
12674330 |
T |
 |
| Q |
315 |
catctgcaaaacagata |
331 |
Q |
| |
|
||| ||||||||||||| |
|
|
| T |
12674329 |
catgtgcaaaacagata |
12674313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 10 - 64
Target Start/End: Complemental strand, 12675142 - 12675088
Alignment:
| Q |
10 |
ccacagatcgtcaaacacctcctccatatctagttgttatggttgtgtcaagtga |
64 |
Q |
| |
|
|||| ||||||| |||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
12675142 |
ccacggatcgtccaacacctcctccatatctggttgttatggttgtgtcaagtga |
12675088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University