View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5737_low_2 (Length: 225)
Name: NF5737_low_2
Description: NF5737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5737_low_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 20 - 217
Target Start/End: Complemental strand, 22278317 - 22278120
Alignment:
| Q |
20 |
aggaggaaggaggtatgggggtgaggtggttaagtgagtttaatgttgcactgttgggaaaatgatgttggtggatcagggtgattgttgtattgtacgt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
22278317 |
aggaggaaggaggtatgggggtgaggtggttaagtgagtttaatgttgcactgttgggaaaatgatgttggtggatcagggggattgttgtattgtacgt |
22278218 |
T |
|
| Q |
120 |
ctgtggcgaggtacgaagtataaagtgggtgggtgaaggaggggagtctgggagggtcgagttggtggaaagatatcgtgaggattcgtgatgatgtc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
22278217 |
ctgtggcgaggtacgaagtataaagtgggtgggtgaaggaggggggtctgggagggtcgagttggtggaaggatatcgtgaggattcgtgatgatgtc |
22278120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 23 - 92
Target Start/End: Original strand, 51072127 - 51072196
Alignment:
| Q |
23 |
aggaaggaggtatgggggtgaggtggttaagtgagtttaatgttgcactgttgggaaaatgatgttggtg |
92 |
Q |
| |
|
||||||||||| ||||||| ||| || | || |||||||||||||| ||||| || ||||| |||||||| |
|
|
| T |
51072127 |
aggaaggaggtttgggggtcaggaggatgagggagtttaatgttgctctgttagggaaatggtgttggtg |
51072196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University