View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5738-Insertion-12 (Length: 203)
Name: NF5738-Insertion-12
Description: NF5738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5738-Insertion-12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 12 - 133
Target Start/End: Complemental strand, 29732463 - 29732342
Alignment:
| Q |
12 |
gggacacacagccggcatgcagtcgctgaaaacaatggtgaaaatgtgtttgagatgggagataaaggttctcactattttcatgttttctactgataat |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29732463 |
gggacacacagccggcatgcagtcgctgaaaacgatggtgaaaatgtgtttgagatgggagataaaggttctcactattttcatgttttctactgataat |
29732364 |
T |
 |
| Q |
112 |
tggattcgccccaaggtcataa |
133 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
29732363 |
tggattcgccccaaggtcataa |
29732342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University