View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5738-Insertion-13 (Length: 148)
Name: NF5738-Insertion-13
Description: NF5738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5738-Insertion-13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 100; Significance: 8e-50; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 100; E-Value: 8e-50
Query Start/End: Original strand, 8 - 143
Target Start/End: Original strand, 3040769 - 3040904
Alignment:
| Q |
8 |
attcacgcaataatcgcaactataatgatgatggttgtttgaatttaattgtaatttttcggaatatcgagaaatacaacttgacttcgatttggaacct |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||| ||||||| ||||| |
|
|
| T |
3040769 |
attcacgcaataatcgcaactataatgatgatggttgtttgaatttaattgtaatttttcgcaatatcaagaaatacaacttgacatcgatttaaaacct |
3040868 |
T |
|
| Q |
108 |
tgcatcgatactagaaggtagaggactgtaagaacc |
143 |
Q |
| |
|
|||||| ||||||||| ||||||||| |||||||| |
|
|
| T |
3040869 |
tgcatctatactagaatttagaggactctaagaacc |
3040904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University