View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5738-Insertion-9 (Length: 303)
Name: NF5738-Insertion-9
Description: NF5738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5738-Insertion-9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 8 - 301
Target Start/End: Complemental strand, 26935982 - 26935689
Alignment:
| Q |
8 |
aaaacaaaggatgagaagaaggcgaagaaggcagaaagtcaagctaaggcacaaaaatctgttggaaaaggcaatgtttctaaaggtgcatcaaaaggtc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26935982 |
aaaacaaaggatgagaagaaggcgaagaaggcagaaagtcaagctaaggcacaaaaatctgttggaaaaggcaatgtttctaaaggtgcatcaaaaggtc |
26935883 |
T |
|
| Q |
108 |
ctaagcttggtggtggaggagggaagcgctgaacccttagtgttgtttccaattttggttagcgcttgaatagagttttgaaacttctgcatcgatannn |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
26935882 |
ctaagcttggtggtggaggagggaagcgctgaacccttagtgttgtttccaattttggttagcacttgaatagagttttgaaacttctgcatcgatattt |
26935783 |
T |
|
| Q |
208 |
nnnngttggatcaatcttgtattttactatcttgtcaaacttttgttggaagatttcccagttactgtttagaattttctgttgagcaaatttg |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
26935782 |
ttttgttggatcaatcttgtattttactatcttgtcaaacttttgttggaagatttcctagttactgtttagaattttctgttgagcaaatttg |
26935689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 216 - 280
Target Start/End: Complemental strand, 3442867 - 3442806
Alignment:
| Q |
216 |
gatcaatcttgtattttactatcttgtcaaacttttgttggaagatttcccagttactgtttaga |
280 |
Q |
| |
|
||||||||||||||||||||||| |||||||| | |||||||||||| |||||||| ||||| |
|
|
| T |
3442867 |
gatcaatcttgtattttactatcctgtcaaac---tcctggaagatttcctagttactgattaga |
3442806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University