View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5738_low_16 (Length: 311)
Name: NF5738_low_16
Description: NF5738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5738_low_16 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 152; Significance: 2e-80; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 17 - 168
Target Start/End: Complemental strand, 21539804 - 21539653
Alignment:
| Q |
17 |
catttccgaatcttgtcgttactgccgcgaatgtgcttgaggtttatgtcgtgagaattcaacatgatgtggcaaaggggaagttgaatgcggattctag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21539804 |
catttccgaatcttgtcgttactgccgcgaatgtgcttgaggtttatgtcgtgagaattcaacatgatgtggcaaaggggaagttgaatgcggattctag |
21539705 |
T |
 |
| Q |
117 |
ggttcttgatggggtgaatggtgccaatcttgaactcgtttgtcattacagg |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21539704 |
ggttcttgatggggtgaatggtgccaatcttgaactcgtttgtcattacagg |
21539653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 224 - 300
Target Start/End: Complemental strand, 21539597 - 21539521
Alignment:
| Q |
224 |
gaatgtgaattggtttgggaaaaataaagtgattttgaatgtgaatttgttgatgtgtttcaatattctgtcttcat |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21539597 |
gaatgtgaattggtttgggaaaaataaagtgattttgaatgtgaatttgttgatgtgtttcaatattctgtcttcat |
21539521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University